SlideShare una empresa de Scribd logo
GENETICA
CONCEPTOS CLAVE
1º BACHILLERATO
TAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCT
GACTGAAGGCTTGAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAG
CCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCT
TGAGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAGCCTTAC
CTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGGCC
AGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAGCCTTACCTTAACC
TAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGAGCTATTATC
CTAGGCGCATTAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACG
GCTGCTAGCTGACTGAAGGCTTGAGGCCAGCTATATTAGCCTATATATCCTAGG
CGCATTAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGC
TAGCTGACTGAAGGCTTGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAG
CTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGAC
TGAAGGCTTGAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAGCCT
TACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTG
AGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAGCCTTACCT
TAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGCTAGC
TGACTGAAGGCTTGAGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAGCT
AGCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTG
AAGGCTTGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGGGCTG
CTAGCTGACTCTAGCCTTACCTTAACCTACCTAAACCTAGGCCTAGCCTACGGCTGCTA
GCTGACTGAAGGCTTGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGGGCTGCT
AGCTGACTCTAGCCTTACCTTAACCTCCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTG
AAGGCTTGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGGGCTGCTAGCTGACT
CTAGCCTTACCTTAACCTCTGACTCTAGCCTTACCTTAACCTCTGACTCTAGCCTTACC
EL LIBRO DE LA VIDA
Estructura del cromosoma metafásico
El cromosoma metafásico está constituido por dos cromátidas unidas por el centrómero
que divide al cromosoma en dos brazos.
BRAZO
BRAZO
Cinetocoro
Centrómero
Constricciones
secundarias
Telómero
Bandas
CONCEPTO DE GEN
• Gen: fragmento de ADN que contiene la información
para un determinado carácter.(proteína para que se
exprese un carácter)
ESTRUCTURA DEL GENOMA
• GENOMA: Conjunto
completo de genes.
• NO todo el ADN
codifica para
proteínas. La mayoría
son gene reguladores
de otros genes o
fragmentos de
función desconocida.
MUTACIONES
• Cambios aleatorios que se producen en el
ADN de un organismo.
• Fuente de variabilidad genética y motor de
la evolución.
• VIDEO
TIPOS DE MUTACIONES
TIPOS DE MUTACIONES
TIPOS DE MUTACIONES
VIDEOS GENÉTICA
• http://recursos.cnice.mec.es
/biosfera/alumno/2bachillerato/biomol
/actividades/videocromatina/
cromatina.htm
• http://recursos.cnice.mec.es
/biosfera/alumno/2bachillerato/biomol
/actividades/videoadn/adn.htm
REPLICACIÓN ADN
• http://www.juntadeandalucia.es/averroes
/manuales/materiales_tic/
Cell_anim_archivos/Cell_anim_archivos/
replicacion_Medina.swf
• Gen: fragmento de
ADN que contiene la
información necesaria
para determinar un
carácter hereditario.
• La posición de un gen
en un cromosoma se
denomina loci.
• Organismos diploides
cada carácter viene
determinado por una
pareja de genes. A
las diversas
alternativas se llaman
ALELO.
• Genotipo: conjunto de genes que posee un
individuo y que ha heredado de sus
progenitores.
• Fenotipo: Conjunto de caracteres que
manifiesta un organismo.
GENÉTICA MENDELIANA
• GENETICA: Es la ciencia que se
encarga del estudio de los
mecanismos de la herencia y las
leyes por las que se rige.
• Mendel demostró que los
caracteres hereditarios estaban
determinados por factores
independientes que se transmitían
de generación en generación. --
GENES.
Caracteres que estudió Mendel
Homocigosis y heterocigosis
• Cuando uno de los
alelos se manifiesta
se dice que el alelo
es dominante.
• El alelo que no se
manifiesta es el alelo
recesivo.
PRÁCTICA
HERENCIA MENDELIANA EN
HUMANOS
• Hay caracteres que no siguen las reglas
de la herencia mendeliana.
• Esto pasa en los siguientes casos:
• Herencia intermedia y codominancia.
• Herencia ligada al sexo.
• Herencia poligénica.
Herencia intermedia
Si ambos alelos
expresan por igual su
información el
resultado es un
individuo con
características
intermedias entre
ambos progenitores.
En cierta especie de plantas los colores de las flores pueden ser rojos, blancos o
rosas. Se sabe que este carácter está determinado por dos genes alelos, rojo (CR)
y blanco (CB) codominantes. ¿Cómo podrán ser los descendientes del cruce entre
plantas de flores rosas con plantas de flores rojas? Haz un esquema de
cruzamiento
• Codominancia:
Si los dos alelos
se manifiestan
simultáneamente
en el individuo.
PRACTICA
SI TODAVIA NO LO VES CLARO Y QUIERES PRACTICAR, AQUÍ TIENES UN ENL
La herencia de los grupos
sanguíneos. Codominancia
Toda persona tiene
alguno de estos
cuatro grupos
sanguíneos:
A
B
AB
O
El grupo sanguíneo está
determinado por los genes
Antes de hacer una
transfusión sanguínea, hay
que tener presentes los
grupos del DONANTE y del
RECEPTOR
La transfusión de sangre es el procedimiento
médico de incorporar sangre o sus derivados
procedentes de un individuo en el sistema
circulatorio de otro, utilizado para mantener con vida
a los pacientes que han sufrido pérdidas excesivas
de sangre por traumas o cirugía, o para proporcionar
algún elemento necesario en caso de enfermedades
que afectan la producción de glóbulos rojos, blancos
o algún otro componente sanguíneo
La herencia de los grupos
sanguíneos. Codominancia
Toda persona tiene
alguno de estos
cuatro grupos
sanguíneos:
A
B
AB
O
El grupo sanguíneo está
determinado por los genes
El grupo sanguíneo depende de la
ausencia o presencia de los
ANTÍGENOS A y B en la sangre, y la
expresión de estos está controlada por
tres posibles alelos: el A, el B y el O
A = B > O
Son codominantes
entre sí
Dominan por
igual al alelo O
La herencia de los grupos
sanguíneos. Codominancia
Los glóbulos rojos son células sanguíneas en cuya membrana hay
unas moléculas que se comportan como antígenos (1) cuando
entran en la sangre de otra persona.
Membrana celular
Molécula antigénica
Glóbulo rojo
(1) Los antígenos son un tipo de proteínas que reaccionan con
otro tipo de proteína llamada ANTICUERPO o aglutinina. En esta
reacción se unen y se produce la aglutinación de la sangre (2).
Lo vimos en 3º E.S.O.
ANTÍGENO ANTICUERPO Se unen las
dos moléculas
(2) Cuando hay aglutinación se forman coágulos de sangre
que pueden ocasionar la muerte de la persona receptora.
Anticuerpo anti-BAntígeno A
Antígeno B
Antígeno A
Antígeno B
Ningún antígeno
A
B
AB
O
Grupos Antígenos Anticuerpos del plasma sanguíneo
Anticuerpo anti-A
Ningún anticuerpo
Anticuerpo anti-B
Anticuerpo anti-A
y
y
Estos son los
antígenos que
hay en los
glóbulos rojos
de las personas
A, B, AB y O
+ provoca reacción
- no provoca reacción
6 Reproducción y herencia
Biología y Geología
4.º ESO
POSIBILIDADES SANGUÍNEAS
¿Pueden tener dos personas tipo A un
hijo con sangre cero?
AO → Tipo A
XAO AO
A OO A
AA AO OOAOGenotipo
Fenotipo A A A O
Dos personas tipo A pueden tener un 75%
de posibilidades de tener un hijo A y 25%
de tener un hijo O.
Imposible B o AB.
¿Pueden tener un AB un hijo de sangre O?
XAB OO
A OB O
AO BO BOAOGenotipo
Fenotipo A A B B
Una persona AB no puede tener un hijo de tipo O
Una persona AB con otra O sólo pueden tener
hijos A ó B.
7 Reproducción y herencia
Biología y Geología
4.º ESO
POSIBILIDADES SANGUÍNEAS 2
¿Pueden tener dos personas tener un hijo
con cualquier tipo de sangre?
XAO BO
A OO B
AB BO OOAOGenotipo
Fenotipo AB A B O
Vemos que hay cualquier posibilidad
¿Qué pasa con los RH?
X+- +-
+ -- +
++ +- --+-Genotipo
Fenotipo + + + -
Dos personas positivas pueden tener hijo negativo
¿Pueden tener dos negativas tener un hijo
positivo?
(+) Es dominante frente al (-)
INICIO ESQUEMA RECURSOS INTERNET
Formas de determinación genética del sexo
SALIRANTERIOR
Determinación
cromosómica
Determinación
ambiental
Determinación
cariotípica
Determinación
génica
Cariotipo de saltamontes
Pepinillo del diablo
(Ecballium elaterium)
Cola de espada
(Xiphophorus)
Abejas
INICIO ESQUEMA RECURSOS INTERNET
Determinación genética del sexo en la especie humana
SALIRANTERIOR
Cada óvulo tiene
22 autosomas y
un cromosoma X
La mitad de los
espermatozoides
llevan 22 autosomas
y un cromosoma X, y
la otra mitad 22
autosomas y un
cromosoma Y
• Síndrome Down – Fertilidad reducida 50%
• XYY- “Superhombre” – Fértil
• XXY- Síndrome de Kinelfelter. Hombre.
“Hipogonadismo” – No fertil por falta de
hormonas.
• XXX- “Supermujer” Síndrome triple X.
Fértil.
• X0 – Síndrome de Turner – Mujer. No
fértil.
X YX Y
Región diferencialRegión diferencial
cromosoma Xcromosoma X Región diferencial
cromosoma Y
RegiónRegión
homólogahomóloga Región homólogaRegión homóloga
• Machos son hemicigotos para los genes localizadosMachos son hemicigotos para los genes localizados
en la región diferencial.en la región diferencial.
• Los genes localizados en la región homóloga seLos genes localizados en la región homóloga se
comportan como genes localizados en autosomascomportan como genes localizados en autosomas
• HERENCIA LIGADA AL CROMOSOMA XHERENCIA LIGADA AL CROMOSOMA X genesgenes
localizados en la región diferencial del cromosoma Xlocalizados en la región diferencial del cromosoma X
• HERENCIA LIGADA AL CROMOSOMA YHERENCIA LIGADA AL CROMOSOMA Y genesgenes
localizados en la región diferencial del cromosoma Ylocalizados en la región diferencial del cromosoma Y
““Homo sapiens”Homo sapiens”
2n= 46 (44 autosomas y XX o XY)2n= 46 (44 autosomas y XX o XY)
INFLUENCIA DEL SEXO EN LA HERENCIA
1.- HERENCIA INFLUIADA POR EL SEXO
En algunos caracteres monogénicos, la relación de dominancia
entre los dos alelos depende del sexo
Ej.: Calvicie en humanos
Presencia de cuernos en vacuno
2.- LIMITACIÓN DE LA EXPRESIÓN DEL CARÁCTER
CON EL SEXO
Un carácter puede expresarse solo en uno de los sexos-
generalmente debido a la presencia o ausencia de una hormona.
Ej.: La letalidad puede estar limitada al sexo
Herencia ligada al sexo
¿Qué es la hemofilia?
La hemofilia es un trastorno
hemorrágico o de coagulación
hereditario. Los niños que tienen
hemofilia carecen de la capacidad
de detener una hemorragia debido
a que su sangre presenta bajos
niveles, o ausencia total, de unas
proteínas específicas denominadas
"factores" que son necesarias para
la coagulación. La correcta
coagulación sanguínea ayuda a
prevenir el sangrado excesivo.
• Ciertos caracteres, como el daltonismo, están determinados
por un gen recesivo (d) ligado al cromosoma X. ¿Cómo podrán
ser los descendientes de un hombre daltónico y una mujer no
daltónica, hija de un hombre daltónico? Haz un esquema de
cruzamiento.
Otra alteración debida a un alelo recesivo es el DALTONISMO.
Consiste en una alteración en la correcta visión de los colores.
Una persona daltónica es incapaz de distinguir
en estas láminas los números 182 y 13
¿Qué ves en estas láminas?
CARACTERES DOMINANTES LIGADOSCARACTERES DOMINANTES LIGADOS
AL CROMOSOMA XAL CROMOSOMA X
-- Los machos afectados transmiten la “condición “Los machos afectados transmiten la “condición “
aa todas sus hijastodas sus hijas, pero a, pero a ningún hijoningún hijo
- Las hembras afectadas transmiten la- Las hembras afectadas transmiten la
condición a lacondición a la mitad de sus descendientesmitad de sus descendientes tantotanto
machos como hembrasmachos como hembras
Ej.: HipofosfatemiaEj.: Hipofosfatemia
Aa
aa
aa
A ?
Aa
A? A?
Padres Enfermos
Hijos sanos CARÁCTER
DOMINANTE
aa
Aa Aa
CARÁCTER RECESIVO
Padres sanos
Hijos enfermos
CARÁCTER
RECESIVO
CARÁCTER DOMINANTE.
Padres enfermos, hijos sanos
PLEIOTROPÍA
• Un gen que afecta a
mas de una
característica
• Ejemplo gen w en
felinos: produce
color blanco y
sordera
• El gen mirlo en
Collie: manchas
grises, microftalmia,
hipoacusia
GENES LETALES
El gen Manx (letal y pleiotrópico
y deletéreo)
• El gen Manx (M) es el
que, en los animales
heterocigotas Mm,
produce el fenotipo
ausencia de cola.
• En Homocigosis
dominante (MM) es
Letal.
• En homocigosis recesiva
mm produce gatos
normales con cola.
GEN DOMINANTE CON EFECTO LETAL RECESIVO
GATO MANX (Falta de cola)
ML
/ ML
Letal
ML
/ M Sin cola
M / M Normal
Problema
• No es fácil encontrar pelos en los perros calvos
mejicanos. En los cruces entre perros calvos mejicanos
y perros normales se obtienen camadas con la mitad de
los animales calvos y la otra mitad normales. Por otro
lado, en los cruces entre perros calvos mejicanos, 2/3 de
la camada son calvos y 1/3 con pelo.
• Además de estos supervivientes, normalmente aparecen
también perros muertos. Estos son calvos y presentan la
misma frecuencia que los que tienen pelo. Da una
explicación y representa los genotipos de los diferentes
tipos de animales.
Interacciones
entre genes
9
:3
:3
:1
EPISTASIAS
• Las epistasias se producen cuando el carácter
estudiado está gobernado por más un locus.
• La situación más sencilla que podemos imaginar sería la
de un carácter controlado por dos loci, cada locus con
un par de alelos: A,a y B,b.
• En este caso, se producen cuando existe influencia
entre alelos de distintos loci (influencia de los alelos A y
a sobre los alelos B y b y viceversa).
Dos genes afectando al mismo carácter
1.- Sin modificación de la proporción 9:3:3:1
Ej: Forma de la cresta en las aves de corral
2.- Modificación de las proporción 9:3:3:1
EPISTASIA
Dominante 12 : 3 : 1
Reccesiva 9 : 3 : 4
Dominante (genes duplicados) 15 : 1
Recesiva (genes complementarios) 9 : 7
Dominante y Recesiva 13 : 3
SIMPLE
DOBLE
Interacciones entre genes:
Epistasias
(≠9:3:3:1)
epistasia: ‘predominar sobre’
gen epistático inhibe la acción del gen hipostático
O = pigmento naranja
B = pigmento negro
EPISTASIA
Sin modificación de la
segregación 9:3:3:1
en la serpiente del maíz
EPISTASIA SIMPLE DOMINANTE
• El alelo dominante de
uno de los dos loci (por
ejemplo el alelo A)
suprime la acción de los
alelos B y b del otro
locus.
• En el caso de las mazorcas de
maíz. El alelo dominante del locus
A produce color Púrpura en la
aleurona (proteína externa) que
impide ver color del endospermo,
solamente cuando las plantas son
aa (aleurona incolora) es posible
observar el color del endospermo
que está controlado por un locus
cuyo alelo dominante B da lugar a
pigmento amarillo y el recesivo b
bloque la síntesis de dicho
pigmento.
Negro 9/16A_b_ Castaño 3/16 aaB_ Oro 3/16 A_bb
1/16 aabb
• aaB_: amarillo con
almohadillas,
hocico negro y
rimmel
• aabb: amarillo con
despigmentación
general
FENOTIPOS
9 púrpuras : 7 blancas
genes
complementarios
Epistasia doble recesiva (9:7)
EPISTASIA DOBLE DOMINANTE RECESIVA 13:3
Ej. Color en pelaje de mamíferos: conejos himalaya y gatos siameses
C - Permite pigmento ( melanina) > c – albino
I – Inhibe pigmento > i permite pigmento
cb
- pigmento solo depositado zonas dependiendo del calor corporal. Zonas cálidas no
producen melanina.
En Tª baja como extremidades, orejas, cola, pies, hocico, produce melanina.
Dos loci independientes,( A Y b, B) controlan el color en el pelo. El alelo A
produce melanina, el alelo a no produce.
El alelo B es un inhibidor de la pigmentación porque no permite la producción
del producto intermediario (DOPA). El b si produce el intermediario
FENOTIPO DEPENDIENTE DE VARIOS GENES.
INTERACCIONES ENTRE GENES
• Además hay más genes:
Cromosoma 15  Densidad del Estroma
Poligénico: AA, Aa, aa
http://genetics.thetech.org/online-exhibits/what-color-eyes-will-your-children-have
Herencia poligénica
• Carácter determinados por la acción de más de un gen
que pueden tener además más de dos alelos, lo cual
origina numerosas combinaciones que son la causa de
que exista una gradación en los fenotipos; es típico de
caracteres cuantitativos, es decir, que se pueden medir
con alguna unidad de medida (peso, altura, longitud de
las patas, número de granos por espiga, número de
huevos, litros de leche, etc.).
• También se debe a este tipo de herencia el color de la
piel en nuestra especie, por eso existen tantas
posibilidades y tanta variación del color de la piel entre
blancos y negros.
• Posibles tonos de
piel con su
respectivo
genotipo,
indicando la
influencia de los
alelos dominantes
en el tono del
color.
• Distribución de los fenotipos de la F2 en una curva. Los tonos que se obtienen en la piel en
seres humanos puede ser explicada si se asume que éstos están bajo el control de tres pares de
alelos. Si un individuo trihíbrido se cruza con otro trihíbrido, el rango de tonos que se pueden
obtener se ilustran en el cuadro de Punnett. El número de alelos dominantes de cada individuo
está representado por un número de círculos oscuros.
11. La polygénie (gènes cumulatifs ou quantitatifs)
C’est le fait que plusieurs gènes «situés à des locus différents» influencent un
seul aspect du phénotype (un seul caractère). Les effets de ces gènes
s'additionnent et produisent différents résultats intermédiaires (variation
continue d'un caractère).
La taille des individus
d’une population est
aussi déterminée par
plusieurs paires de
gènes.
La couleur de la peau
dépend de (3) paires de
gènes.
Albinos Très noir
Campbell (3e
éd.) — Figure 14.12 : 284
94
Penetrancia y expresividad
Ambos conceptos se refieren a la expresión fenotípica variable de
ciertos genes
Penetrancia: Proporción de individuos en una población que
presentan el fenotipo correspondiente a su genotipo. Si P < 1 se
habla de penetrancia incompleta
Expresividad: El grado de expresión individual de un fenotipo para
un genotipo dado
95
Expresividad
10 grados de expresividad variable en el carácter
piel manchada en perros.
96
•Impronta parental
•Ejemplo
Factor crecimiento II tipo insulina (Igf2) en ratón.
Mutante homocigoto -> enano.
El fenotipo del heterocigoto depende del origen del alelo
Alelo salvaje es paterno -> fenotipo salvaje
Alelo salvaje es materno -> fenotipo enano
•Edad de aparición de un fenotipo
•Temprana
•Tardía
Aparición tardía de la
enfermedad de Huntington
• En los ratones de campo existe un gen que determina el color pelo
amarillo y que es dominante sobre el que determina el color normal
o de tipo salvaje. El tamaño de la cola esta determinada por una
pareja alélica, de tal manera que el gen dominante determina
tamaño de cola corta mientras que el recesivo determina tamaño
normal o de tipo salvaje. Ambas parejas de genes se transmiten a
la descendencia independientemente la una de la otra. Aquellos
embriones que son homocigotos para uno o para los dos genes
dominantes mueren antes de nacer. ¿En qué proporción y cómo
serán los fenotipos de la descendencia de un cruzamiento entre un
macho de color amarillo y cola corta con una hembra de las mismas
características?
Gemelos y Mellizos
• GEMELOS
1 óvulo + 1 espermatozoide + suerte
• MELLIZOS:
2 óvulos + 2 espermatozoides
SINDROME DE EDWARDS
INICIO ESQUEMA RECURSOS INTERNET
Meiosis y ciclos biológicos
SALIRANTERIOR
Ciclo diplonte
Ciclo haplonte
Ciclo diplohaplonte
INICIO ESQUEMA RECURSOS INTERNET
Meiosis y ciclos biológicos
SALIRANTERIOR
Ciclo haplonte
VOLVER
En algas
y hongos
unicelulares
HAPLOIDE
DIPLOIDEDIPLOIDE
Cigoto
(2n)
Fecundación
Meiosis
Célula (n)
Gametos (n)
Fusión de gametos
INICIO ESQUEMA RECURSOS INTERNET
Meiosis y ciclos biológicos
SALIRANTERIOR
Ciclo diplohaplonte VOLVER
En plantas y en
algunas algas
y hongos
Gametos (n)
HAPLOIDE
DIPLOIDEDIPLOIDE
Fecundación
Meiosis
Esporas (n)
Cigoto
(2n)
(n)
(2n)
INICIO ESQUEMA RECURSOS INTERNET
Meiosis y ciclos biológicos
SALIRANTERIOR
Ciclo diplonte
VOLVER
En casi todos
los animales
HAPLOIDEDIPLOIDEDIPLOIDE
Fecundación
Cigoto
(2n)
Gametos (n)
(2n)

Más contenido relacionado

La actualidad más candente

3.3 Genetica
3.3 Genetica3.3 Genetica
3.3 Genetica
Jorge Arizpe Dodero
 
Practica disección
Practica disecciónPractica disección
Practica disección
Zuryfree
 
Reporte de trabajo de Laboratorio con Drosophila melanogaster
Reporte de trabajo de Laboratorio con Drosophila melanogasterReporte de trabajo de Laboratorio con Drosophila melanogaster
Reporte de trabajo de Laboratorio con Drosophila melanogaster
lauradelvalle
 
Anatomía mamíferos (ratón laboratorio)
Anatomía mamíferos (ratón laboratorio)Anatomía mamíferos (ratón laboratorio)
Anatomía mamíferos (ratón laboratorio)
Fraan González
 
Herencia no mendeliana
Herencia no mendelianaHerencia no mendeliana
Herencia no mendeliana
Adriana Meza
 
Genética: Alelos
Genética: AlelosGenética: Alelos
Recombinación del adn
Recombinación del adnRecombinación del adn
Recombinación del adn
Karen Alex
 
Que son los genes
Que son los genesQue son los genes
Que son los genes
Jose Hernandez Landa
 
Hidrólisis del almidón por la amilasa salival
Hidrólisis del almidón por la amilasa salivalHidrólisis del almidón por la amilasa salival
Hidrólisis del almidón por la amilasa salival
Lizbeth Nicolaza Dámazo Gálvez
 
Endogamia
Endogamia Endogamia
Endogamia
Jessica Ochoa
 
ligamiento y recombinación
ligamiento y recombinaciónligamiento y recombinación
ligamiento y recombinación
Jordi Bas
 
Herencia
HerenciaHerencia
Herencia
Cuartomedio2010
 
Ciencias ómicas
Ciencias ómicasCiencias ómicas
Ciencias ómicas
Lida Ines Mancilla Estacio
 
Tema3 las leyes de la herencia
Tema3 las leyes de la herenciaTema3 las leyes de la herencia
Tema3 las leyes de la herencia
geopaloma
 
Sintesis de proteinas
Sintesis de proteinasSintesis de proteinas
Sintesis de proteinas
silvia gutierrez contreras
 
Replicacion del adn
Replicacion del adnReplicacion del adn
Replicacion del adn
maria eugenia muñoz
 
ETOLOGIA_3_4_Cuidado parental
ETOLOGIA_3_4_Cuidado parentalETOLOGIA_3_4_Cuidado parental
ETOLOGIA_3_4_Cuidado parental
Freire Juan
 
Terminologia de la genetica
Terminologia de la geneticaTerminologia de la genetica
Terminologia de la genetica
Ramiro Muñoz
 
Ejercicios resueltos de Genética Cuantitativa
Ejercicios resueltos de Genética CuantitativaEjercicios resueltos de Genética Cuantitativa
Ejercicios resueltos de Genética Cuantitativa
CiberGeneticaUNAM
 
5 interacción de genes no alélicos
5 interacción de genes no alélicos5 interacción de genes no alélicos
5 interacción de genes no alélicos
Roddy Arela
 

La actualidad más candente (20)

3.3 Genetica
3.3 Genetica3.3 Genetica
3.3 Genetica
 
Practica disección
Practica disecciónPractica disección
Practica disección
 
Reporte de trabajo de Laboratorio con Drosophila melanogaster
Reporte de trabajo de Laboratorio con Drosophila melanogasterReporte de trabajo de Laboratorio con Drosophila melanogaster
Reporte de trabajo de Laboratorio con Drosophila melanogaster
 
Anatomía mamíferos (ratón laboratorio)
Anatomía mamíferos (ratón laboratorio)Anatomía mamíferos (ratón laboratorio)
Anatomía mamíferos (ratón laboratorio)
 
Herencia no mendeliana
Herencia no mendelianaHerencia no mendeliana
Herencia no mendeliana
 
Genética: Alelos
Genética: AlelosGenética: Alelos
Genética: Alelos
 
Recombinación del adn
Recombinación del adnRecombinación del adn
Recombinación del adn
 
Que son los genes
Que son los genesQue son los genes
Que son los genes
 
Hidrólisis del almidón por la amilasa salival
Hidrólisis del almidón por la amilasa salivalHidrólisis del almidón por la amilasa salival
Hidrólisis del almidón por la amilasa salival
 
Endogamia
Endogamia Endogamia
Endogamia
 
ligamiento y recombinación
ligamiento y recombinaciónligamiento y recombinación
ligamiento y recombinación
 
Herencia
HerenciaHerencia
Herencia
 
Ciencias ómicas
Ciencias ómicasCiencias ómicas
Ciencias ómicas
 
Tema3 las leyes de la herencia
Tema3 las leyes de la herenciaTema3 las leyes de la herencia
Tema3 las leyes de la herencia
 
Sintesis de proteinas
Sintesis de proteinasSintesis de proteinas
Sintesis de proteinas
 
Replicacion del adn
Replicacion del adnReplicacion del adn
Replicacion del adn
 
ETOLOGIA_3_4_Cuidado parental
ETOLOGIA_3_4_Cuidado parentalETOLOGIA_3_4_Cuidado parental
ETOLOGIA_3_4_Cuidado parental
 
Terminologia de la genetica
Terminologia de la geneticaTerminologia de la genetica
Terminologia de la genetica
 
Ejercicios resueltos de Genética Cuantitativa
Ejercicios resueltos de Genética CuantitativaEjercicios resueltos de Genética Cuantitativa
Ejercicios resueltos de Genética Cuantitativa
 
5 interacción de genes no alélicos
5 interacción de genes no alélicos5 interacción de genes no alélicos
5 interacción de genes no alélicos
 

Destacado

15 problemas genética resueltos y explicados
15 problemas genética resueltos y explicados15 problemas genética resueltos y explicados
15 problemas genética resueltos y explicados
mperille
 
18 problemas de genética (resueltos)
18 problemas de genética (resueltos)18 problemas de genética (resueltos)
18 problemas de genética (resueltos)
1mario1888555
 
Genes letales
Genes letalesGenes letales
Genes letales
Bryan Fernando Reyes
 
3 alelos letales
3 alelos letales3 alelos letales
3 alelos letales
Roddy Arela
 
28 Problemas Resueltos De Genética
28 Problemas Resueltos De Genética28 Problemas Resueltos De Genética
28 Problemas Resueltos De Genética
Raúl Hurtado
 
Alteraciones de la informacion genetica dario paredes
Alteraciones de la informacion genetica dario paredesAlteraciones de la informacion genetica dario paredes
Alteraciones de la informacion genetica dario paredes
Dario Paredes
 
Ciencias naturales9
Ciencias naturales9Ciencias naturales9
Ciencias naturales9
camilo torres
 
Genetica Seminario Ligadas al X
Genetica Seminario Ligadas al XGenetica Seminario Ligadas al X
Genetica Seminario Ligadas al X
BernardoOro
 
Alteraciones de la información genética.
Alteraciones de la información genética. Alteraciones de la información genética.
Alteraciones de la información genética.
jgclar
 
Relación problemas genética
Relación problemas genéticaRelación problemas genética
Relación problemas genética
pilarduranperez
 
Problemas genéticos LA EDUCACION SUPERIOR TECNOLOGICA PROMUEVE INVESTIGACION
Problemas genéticos  LA EDUCACION SUPERIOR TECNOLOGICA PROMUEVE INVESTIGACIONProblemas genéticos  LA EDUCACION SUPERIOR TECNOLOGICA PROMUEVE INVESTIGACION
Problemas genéticos LA EDUCACION SUPERIOR TECNOLOGICA PROMUEVE INVESTIGACION
Iestp Asm Protesis Dental
 
Pleiotropía y genes letales
Pleiotropía y genes letalesPleiotropía y genes letales
Pleiotropía y genes letales
CiberGeneticaUNAM
 
Hemofilia A y B
Hemofilia A y BHemofilia A y B
Hemofilia A y B
Miguel Llanos
 
Ejercicios con pedigrees
Ejercicios con pedigreesEjercicios con pedigrees
Genetica
GeneticaGenetica
Genetica
guest722a4cb
 
Plan de grado 8 y 9 biologia
Plan de grado 8 y 9 biologia Plan de grado 8 y 9 biologia
Plan de grado 8 y 9 biologia
FELIX HERNANDEZ
 
Herencia de los Grupos Sanguineos
Herencia de los Grupos SanguineosHerencia de los Grupos Sanguineos
Herencia de los Grupos Sanguineos
Gilberto Cabrera Molina
 
Problemas de Genética
Problemas de GenéticaProblemas de Genética
Problemas de Genética
Miguel Romero
 
ALTERACIONES DE LA INFORMACÓN GENÉTICA
ALTERACIONES DE LA INFORMACÓN GENÉTICAALTERACIONES DE LA INFORMACÓN GENÉTICA
ALTERACIONES DE LA INFORMACÓN GENÉTICA
Eyra Araujo
 

Destacado (19)

15 problemas genética resueltos y explicados
15 problemas genética resueltos y explicados15 problemas genética resueltos y explicados
15 problemas genética resueltos y explicados
 
18 problemas de genética (resueltos)
18 problemas de genética (resueltos)18 problemas de genética (resueltos)
18 problemas de genética (resueltos)
 
Genes letales
Genes letalesGenes letales
Genes letales
 
3 alelos letales
3 alelos letales3 alelos letales
3 alelos letales
 
28 Problemas Resueltos De Genética
28 Problemas Resueltos De Genética28 Problemas Resueltos De Genética
28 Problemas Resueltos De Genética
 
Alteraciones de la informacion genetica dario paredes
Alteraciones de la informacion genetica dario paredesAlteraciones de la informacion genetica dario paredes
Alteraciones de la informacion genetica dario paredes
 
Ciencias naturales9
Ciencias naturales9Ciencias naturales9
Ciencias naturales9
 
Genetica Seminario Ligadas al X
Genetica Seminario Ligadas al XGenetica Seminario Ligadas al X
Genetica Seminario Ligadas al X
 
Alteraciones de la información genética.
Alteraciones de la información genética. Alteraciones de la información genética.
Alteraciones de la información genética.
 
Relación problemas genética
Relación problemas genéticaRelación problemas genética
Relación problemas genética
 
Problemas genéticos LA EDUCACION SUPERIOR TECNOLOGICA PROMUEVE INVESTIGACION
Problemas genéticos  LA EDUCACION SUPERIOR TECNOLOGICA PROMUEVE INVESTIGACIONProblemas genéticos  LA EDUCACION SUPERIOR TECNOLOGICA PROMUEVE INVESTIGACION
Problemas genéticos LA EDUCACION SUPERIOR TECNOLOGICA PROMUEVE INVESTIGACION
 
Pleiotropía y genes letales
Pleiotropía y genes letalesPleiotropía y genes letales
Pleiotropía y genes letales
 
Hemofilia A y B
Hemofilia A y BHemofilia A y B
Hemofilia A y B
 
Ejercicios con pedigrees
Ejercicios con pedigreesEjercicios con pedigrees
Ejercicios con pedigrees
 
Genetica
GeneticaGenetica
Genetica
 
Plan de grado 8 y 9 biologia
Plan de grado 8 y 9 biologia Plan de grado 8 y 9 biologia
Plan de grado 8 y 9 biologia
 
Herencia de los Grupos Sanguineos
Herencia de los Grupos SanguineosHerencia de los Grupos Sanguineos
Herencia de los Grupos Sanguineos
 
Problemas de Genética
Problemas de GenéticaProblemas de Genética
Problemas de Genética
 
ALTERACIONES DE LA INFORMACÓN GENÉTICA
ALTERACIONES DE LA INFORMACÓN GENÉTICAALTERACIONES DE LA INFORMACÓN GENÉTICA
ALTERACIONES DE LA INFORMACÓN GENÉTICA
 

Similar a Genetica2015

Clase 5 extensión del análisis mendeliano
Clase 5 extensión del análisis mendelianoClase 5 extensión del análisis mendeliano
Clase 5 extensión del análisis mendeliano
Elton Volitzki
 
Ligamiento alelos m-ccp
Ligamiento alelos m-ccpLigamiento alelos m-ccp
Ligamiento alelos m-ccp
biocarmelianas
 
Ligamiento alelos m-ccp
Ligamiento alelos m-ccpLigamiento alelos m-ccp
Ligamiento alelos m-ccp
biocarmelianas
 
GUIA DE GENETICA 9°.pdf
GUIA DE GENETICA 9°.pdfGUIA DE GENETICA 9°.pdf
GUIA DE GENETICA 9°.pdf
AndreaMuoz956054
 
GUIA DE GENETICA 9°.pdf
GUIA DE GENETICA 9°.pdfGUIA DE GENETICA 9°.pdf
GUIA DE GENETICA 9°.pdf
AndreaMuoz956054
 
genetica
geneticagenetica
genetica
Andrey Borda
 
Citogenètica evolutiva. alelos multiples herencia ligada limitdad al sexo
Citogenètica evolutiva. alelos multiples herencia ligada   limitdad al sexoCitogenètica evolutiva. alelos multiples herencia ligada   limitdad al sexo
Citogenètica evolutiva. alelos multiples herencia ligada limitdad al sexo
Leningher Rivera Riplay
 
GENÉTICA HUMANA
GENÉTICA HUMANAGENÉTICA HUMANA
GENÉTICA HUMANA
Pablo Gavete
 
Presentación Tema 4. Genética
Presentación Tema 4. GenéticaPresentación Tema 4. Genética
Presentación Tema 4. Genética
josemanuel7160
 
Genetica humana
Genetica humana Genetica humana
Genetica humana
biologiaricel
 
Alelos multiples y herencia poligenica
Alelos multiples y herencia poligenicaAlelos multiples y herencia poligenica
Alelos multiples y herencia poligenica
Bryan Fernando Reyes
 
Sesion 05 Metodos De La GenéTica Humana
Sesion 05 Metodos De La GenéTica HumanaSesion 05 Metodos De La GenéTica Humana
Sesion 05 Metodos De La GenéTica Humana
medic
 
Genética
GenéticaGenética
Genética
Arturo Blanco
 
Unidad 14. Genética y herencia
Unidad 14. Genética y herenciaUnidad 14. Genética y herencia
Unidad 14. Genética y herencia
Francisco Aparicio
 
Herencia sanguínea y genética_1IB_Equipo_Santiago_Alonso.pdf
Herencia sanguínea y genética_1IB_Equipo_Santiago_Alonso.pdfHerencia sanguínea y genética_1IB_Equipo_Santiago_Alonso.pdf
Herencia sanguínea y genética_1IB_Equipo_Santiago_Alonso.pdf
DahianaBasigaluz
 
6. TEMA 2. GENETICA (1).pptx
6. TEMA 2. GENETICA (1).pptx6. TEMA 2. GENETICA (1).pptx
6. TEMA 2. GENETICA (1).pptx
Mariveliz1
 
La GenéTica Mendeliana
La GenéTica MendelianaLa GenéTica Mendeliana
La GenéTica Mendeliana
Monica Villalobos
 
Genetica humana
Genetica humanaGenetica humana
Genetica humana
Juanjo Vázquez
 
Diapositivas_Genética Mendeliana y post mendeliana (2).pdf
Diapositivas_Genética Mendeliana y post mendeliana  (2).pdfDiapositivas_Genética Mendeliana y post mendeliana  (2).pdf
Diapositivas_Genética Mendeliana y post mendeliana (2).pdf
Manuel Siguencia Piña
 
GENETICA SEMANA1.pptx
GENETICA SEMANA1.pptxGENETICA SEMANA1.pptx
GENETICA SEMANA1.pptx
JEISSONDAVIDCABOSSAN
 

Similar a Genetica2015 (20)

Clase 5 extensión del análisis mendeliano
Clase 5 extensión del análisis mendelianoClase 5 extensión del análisis mendeliano
Clase 5 extensión del análisis mendeliano
 
Ligamiento alelos m-ccp
Ligamiento alelos m-ccpLigamiento alelos m-ccp
Ligamiento alelos m-ccp
 
Ligamiento alelos m-ccp
Ligamiento alelos m-ccpLigamiento alelos m-ccp
Ligamiento alelos m-ccp
 
GUIA DE GENETICA 9°.pdf
GUIA DE GENETICA 9°.pdfGUIA DE GENETICA 9°.pdf
GUIA DE GENETICA 9°.pdf
 
GUIA DE GENETICA 9°.pdf
GUIA DE GENETICA 9°.pdfGUIA DE GENETICA 9°.pdf
GUIA DE GENETICA 9°.pdf
 
genetica
geneticagenetica
genetica
 
Citogenètica evolutiva. alelos multiples herencia ligada limitdad al sexo
Citogenètica evolutiva. alelos multiples herencia ligada   limitdad al sexoCitogenètica evolutiva. alelos multiples herencia ligada   limitdad al sexo
Citogenètica evolutiva. alelos multiples herencia ligada limitdad al sexo
 
GENÉTICA HUMANA
GENÉTICA HUMANAGENÉTICA HUMANA
GENÉTICA HUMANA
 
Presentación Tema 4. Genética
Presentación Tema 4. GenéticaPresentación Tema 4. Genética
Presentación Tema 4. Genética
 
Genetica humana
Genetica humana Genetica humana
Genetica humana
 
Alelos multiples y herencia poligenica
Alelos multiples y herencia poligenicaAlelos multiples y herencia poligenica
Alelos multiples y herencia poligenica
 
Sesion 05 Metodos De La GenéTica Humana
Sesion 05 Metodos De La GenéTica HumanaSesion 05 Metodos De La GenéTica Humana
Sesion 05 Metodos De La GenéTica Humana
 
Genética
GenéticaGenética
Genética
 
Unidad 14. Genética y herencia
Unidad 14. Genética y herenciaUnidad 14. Genética y herencia
Unidad 14. Genética y herencia
 
Herencia sanguínea y genética_1IB_Equipo_Santiago_Alonso.pdf
Herencia sanguínea y genética_1IB_Equipo_Santiago_Alonso.pdfHerencia sanguínea y genética_1IB_Equipo_Santiago_Alonso.pdf
Herencia sanguínea y genética_1IB_Equipo_Santiago_Alonso.pdf
 
6. TEMA 2. GENETICA (1).pptx
6. TEMA 2. GENETICA (1).pptx6. TEMA 2. GENETICA (1).pptx
6. TEMA 2. GENETICA (1).pptx
 
La GenéTica Mendeliana
La GenéTica MendelianaLa GenéTica Mendeliana
La GenéTica Mendeliana
 
Genetica humana
Genetica humanaGenetica humana
Genetica humana
 
Diapositivas_Genética Mendeliana y post mendeliana (2).pdf
Diapositivas_Genética Mendeliana y post mendeliana  (2).pdfDiapositivas_Genética Mendeliana y post mendeliana  (2).pdf
Diapositivas_Genética Mendeliana y post mendeliana (2).pdf
 
GENETICA SEMANA1.pptx
GENETICA SEMANA1.pptxGENETICA SEMANA1.pptx
GENETICA SEMANA1.pptx
 

Más de Rafa Martín

tema13-Geneticamendel2021.ppt
tema13-Geneticamendel2021.ppttema13-Geneticamendel2021.ppt
tema13-Geneticamendel2021.ppt
Rafa Martín
 
Variabilidad.ppt
Variabilidad.pptVariabilidad.ppt
Variabilidad.ppt
Rafa Martín
 
Biodiversidad.ppt
Biodiversidad.pptBiodiversidad.ppt
Biodiversidad.ppt
Rafa Martín
 
Modelos evolutivos.ppt
Modelos evolutivos.pptModelos evolutivos.ppt
Modelos evolutivos.ppt
Rafa Martín
 
poblacion_humana.ppt
poblacion_humana.pptpoblacion_humana.ppt
poblacion_humana.ppt
Rafa Martín
 
Proteccion de datos
Proteccion de datosProteccion de datos
Proteccion de datos
Rafa Martín
 
Biodiversidad y evolución
Biodiversidad y evoluciónBiodiversidad y evolución
Biodiversidad y evolución
Rafa Martín
 
Tema7- 1ª parte
Tema7- 1ª parteTema7- 1ª parte
Tema7- 1ª parte
Rafa Martín
 
Selectividad biología
Selectividad biologíaSelectividad biología
Selectividad biología
Rafa Martín
 
Ejercicios glucidos
Ejercicios glucidosEjercicios glucidos
Ejercicios glucidos
Rafa Martín
 
Tema3 b. seres vivos metabolismo
Tema3 b. seres vivos metabolismoTema3 b. seres vivos metabolismo
Tema3 b. seres vivos metabolismo
Rafa Martín
 
Tema3 lipidos
Tema3 lipidosTema3 lipidos
Tema3 lipidos
Rafa Martín
 
T 2-biomoléculas
T 2-biomoléculasT 2-biomoléculas
T 2-biomoléculas
Rafa Martín
 
Bioelementos
BioelementosBioelementos
Bioelementos
Rafa Martín
 
Tema 2 lomce
Tema 2 lomceTema 2 lomce
Tema 2 lomce
Rafa Martín
 
Tema1 lomce
Tema1 lomceTema1 lomce
Tema1 lomce
Rafa Martín
 
Tema7 plantas2
Tema7 plantas2Tema7 plantas2
Tema7 plantas2
Rafa Martín
 
16 mamiferos
16 mamiferos16 mamiferos
16 mamiferos
Rafa Martín
 
14 reptiles
14 reptiles14 reptiles
14 reptiles
Rafa Martín
 
Cordados
CordadosCordados
Cordados
Rafa Martín
 

Más de Rafa Martín (20)

tema13-Geneticamendel2021.ppt
tema13-Geneticamendel2021.ppttema13-Geneticamendel2021.ppt
tema13-Geneticamendel2021.ppt
 
Variabilidad.ppt
Variabilidad.pptVariabilidad.ppt
Variabilidad.ppt
 
Biodiversidad.ppt
Biodiversidad.pptBiodiversidad.ppt
Biodiversidad.ppt
 
Modelos evolutivos.ppt
Modelos evolutivos.pptModelos evolutivos.ppt
Modelos evolutivos.ppt
 
poblacion_humana.ppt
poblacion_humana.pptpoblacion_humana.ppt
poblacion_humana.ppt
 
Proteccion de datos
Proteccion de datosProteccion de datos
Proteccion de datos
 
Biodiversidad y evolución
Biodiversidad y evoluciónBiodiversidad y evolución
Biodiversidad y evolución
 
Tema7- 1ª parte
Tema7- 1ª parteTema7- 1ª parte
Tema7- 1ª parte
 
Selectividad biología
Selectividad biologíaSelectividad biología
Selectividad biología
 
Ejercicios glucidos
Ejercicios glucidosEjercicios glucidos
Ejercicios glucidos
 
Tema3 b. seres vivos metabolismo
Tema3 b. seres vivos metabolismoTema3 b. seres vivos metabolismo
Tema3 b. seres vivos metabolismo
 
Tema3 lipidos
Tema3 lipidosTema3 lipidos
Tema3 lipidos
 
T 2-biomoléculas
T 2-biomoléculasT 2-biomoléculas
T 2-biomoléculas
 
Bioelementos
BioelementosBioelementos
Bioelementos
 
Tema 2 lomce
Tema 2 lomceTema 2 lomce
Tema 2 lomce
 
Tema1 lomce
Tema1 lomceTema1 lomce
Tema1 lomce
 
Tema7 plantas2
Tema7 plantas2Tema7 plantas2
Tema7 plantas2
 
16 mamiferos
16 mamiferos16 mamiferos
16 mamiferos
 
14 reptiles
14 reptiles14 reptiles
14 reptiles
 
Cordados
CordadosCordados
Cordados
 

Último

Clasificación de los animales vertebrados
Clasificación de los animales vertebradosClasificación de los animales vertebrados
Clasificación de los animales vertebrados
DianaLopez859290
 
CUADRO COMPARATIVO Aylen.docx............
CUADRO COMPARATIVO Aylen.docx............CUADRO COMPARATIVO Aylen.docx............
CUADRO COMPARATIVO Aylen.docx............
LuanaJaime1
 
Fundamentos filosóficos de la metodología de la enseñanza .pdf
Fundamentos filosóficos de la metodología de la enseñanza .pdfFundamentos filosóficos de la metodología de la enseñanza .pdf
Fundamentos filosóficos de la metodología de la enseñanza .pdf
AnaisMundaray
 
Apoplejia_UNIVERSIDAD CENTRAL DEL ECUADOR
Apoplejia_UNIVERSIDAD CENTRAL DEL ECUADORApoplejia_UNIVERSIDAD CENTRAL DEL ECUADOR
Apoplejia_UNIVERSIDAD CENTRAL DEL ECUADOR
NicoleEnriquez19
 
DIPLOMA Teachers For Future junio2024.pdf
DIPLOMA Teachers For Future junio2024.pdfDIPLOMA Teachers For Future junio2024.pdf
DIPLOMA Teachers For Future junio2024.pdf
Alfaresbilingual
 
Ejercicios propuestos (if , switch).docx
Ejercicios propuestos (if , switch).docxEjercicios propuestos (if , switch).docx
Ejercicios propuestos (if , switch).docx
sebastianjacome1808
 
Marketing responsable - Ética y Responsabilidad Social Empresarial
Marketing responsable - Ética y Responsabilidad Social EmpresarialMarketing responsable - Ética y Responsabilidad Social Empresarial
Marketing responsable - Ética y Responsabilidad Social Empresarial
JonathanCovena1
 
princupalesplagasyenfermedadesdelpaltopdf-230717165119-fd68bcac.pdf
princupalesplagasyenfermedadesdelpaltopdf-230717165119-fd68bcac.pdfprincupalesplagasyenfermedadesdelpaltopdf-230717165119-fd68bcac.pdf
princupalesplagasyenfermedadesdelpaltopdf-230717165119-fd68bcac.pdf
Elvis Bailón de la Cruz
 
Ensayo sobre José María Arguedas Peruanodocx
Ensayo sobre José María Arguedas PeruanodocxEnsayo sobre José María Arguedas Peruanodocx
Ensayo sobre José María Arguedas Peruanodocx
danelycacchavaldivia
 
Maikell-Victor-Quimica-2024-Volume-2.pdf
Maikell-Victor-Quimica-2024-Volume-2.pdfMaikell-Victor-Quimica-2024-Volume-2.pdf
Maikell-Victor-Quimica-2024-Volume-2.pdf
DevinsideSolutions
 
Calidad de vida laboral - Ética y Responsabilidad Social Empresarial
Calidad de vida laboral - Ética y Responsabilidad Social EmpresarialCalidad de vida laboral - Ética y Responsabilidad Social Empresarial
Calidad de vida laboral - Ética y Responsabilidad Social Empresarial
JonathanCovena1
 
FRASE CÉLEBRE OLÍMPICA EN ROMPECABEZAS. Por JAVIER SOLIS NOYOLA
FRASE CÉLEBRE OLÍMPICA EN ROMPECABEZAS. Por JAVIER SOLIS NOYOLAFRASE CÉLEBRE OLÍMPICA EN ROMPECABEZAS. Por JAVIER SOLIS NOYOLA
FRASE CÉLEBRE OLÍMPICA EN ROMPECABEZAS. Por JAVIER SOLIS NOYOLA
JAVIER SOLIS NOYOLA
 
Mapa-conceptual-de-la-Evolucion-del-Hombre-3.pptx
Mapa-conceptual-de-la-Evolucion-del-Hombre-3.pptxMapa-conceptual-de-la-Evolucion-del-Hombre-3.pptx
Mapa-conceptual-de-la-Evolucion-del-Hombre-3.pptx
ElizabethLpez634570
 
5° T3 EDITABLE EVALUACIÓN DARUKEL 2023-2024.pdf
5° T3 EDITABLE EVALUACIÓN DARUKEL 2023-2024.pdf5° T3 EDITABLE EVALUACIÓN DARUKEL 2023-2024.pdf
5° T3 EDITABLE EVALUACIÓN DARUKEL 2023-2024.pdf
manuelhinojosa1950
 
Gui_a para el uso de IA generativa en educacio_n e investigacio_n - UNESCO.pdf
Gui_a para el uso de IA generativa en educacio_n e investigacio_n - UNESCO.pdfGui_a para el uso de IA generativa en educacio_n e investigacio_n - UNESCO.pdf
Gui_a para el uso de IA generativa en educacio_n e investigacio_n - UNESCO.pdf
FRANCISCO PAVON RABASCO
 
Sesión: Los acontecimientos finales de la tierra
Sesión: Los acontecimientos finales de la tierraSesión: Los acontecimientos finales de la tierra
Sesión: Los acontecimientos finales de la tierra
https://gramadal.wordpress.com/
 
REGIMÉN ACADÉMICO PARA LA EDUCACIÓN SECUNDARIA - RESOC-2024-1650-GDEBA-DGC...
REGIMÉN ACADÉMICO PARA LA EDUCACIÓN SECUNDARIA - RESOC-2024-1650-GDEBA-DGC...REGIMÉN ACADÉMICO PARA LA EDUCACIÓN SECUNDARIA - RESOC-2024-1650-GDEBA-DGC...
REGIMÉN ACADÉMICO PARA LA EDUCACIÓN SECUNDARIA - RESOC-2024-1650-GDEBA-DGC...
carla526481
 
Evaluacion-Formativa-Nueva Escuela Mexicana NEM-ok.pdf
Evaluacion-Formativa-Nueva Escuela Mexicana NEM-ok.pdfEvaluacion-Formativa-Nueva Escuela Mexicana NEM-ok.pdf
Evaluacion-Formativa-Nueva Escuela Mexicana NEM-ok.pdf
EfranMartnez8
 
Fundamentos metodología deenseñanza.pptx
Fundamentos metodología deenseñanza.pptxFundamentos metodología deenseñanza.pptx
Fundamentos metodología deenseñanza.pptx
pedro827vasquez
 
Jesús calma la tempestad el mar de en.docx
Jesús calma la tempestad el mar de en.docxJesús calma la tempestad el mar de en.docx
Jesús calma la tempestad el mar de en.docx
JRAA3
 

Último (20)

Clasificación de los animales vertebrados
Clasificación de los animales vertebradosClasificación de los animales vertebrados
Clasificación de los animales vertebrados
 
CUADRO COMPARATIVO Aylen.docx............
CUADRO COMPARATIVO Aylen.docx............CUADRO COMPARATIVO Aylen.docx............
CUADRO COMPARATIVO Aylen.docx............
 
Fundamentos filosóficos de la metodología de la enseñanza .pdf
Fundamentos filosóficos de la metodología de la enseñanza .pdfFundamentos filosóficos de la metodología de la enseñanza .pdf
Fundamentos filosóficos de la metodología de la enseñanza .pdf
 
Apoplejia_UNIVERSIDAD CENTRAL DEL ECUADOR
Apoplejia_UNIVERSIDAD CENTRAL DEL ECUADORApoplejia_UNIVERSIDAD CENTRAL DEL ECUADOR
Apoplejia_UNIVERSIDAD CENTRAL DEL ECUADOR
 
DIPLOMA Teachers For Future junio2024.pdf
DIPLOMA Teachers For Future junio2024.pdfDIPLOMA Teachers For Future junio2024.pdf
DIPLOMA Teachers For Future junio2024.pdf
 
Ejercicios propuestos (if , switch).docx
Ejercicios propuestos (if , switch).docxEjercicios propuestos (if , switch).docx
Ejercicios propuestos (if , switch).docx
 
Marketing responsable - Ética y Responsabilidad Social Empresarial
Marketing responsable - Ética y Responsabilidad Social EmpresarialMarketing responsable - Ética y Responsabilidad Social Empresarial
Marketing responsable - Ética y Responsabilidad Social Empresarial
 
princupalesplagasyenfermedadesdelpaltopdf-230717165119-fd68bcac.pdf
princupalesplagasyenfermedadesdelpaltopdf-230717165119-fd68bcac.pdfprincupalesplagasyenfermedadesdelpaltopdf-230717165119-fd68bcac.pdf
princupalesplagasyenfermedadesdelpaltopdf-230717165119-fd68bcac.pdf
 
Ensayo sobre José María Arguedas Peruanodocx
Ensayo sobre José María Arguedas PeruanodocxEnsayo sobre José María Arguedas Peruanodocx
Ensayo sobre José María Arguedas Peruanodocx
 
Maikell-Victor-Quimica-2024-Volume-2.pdf
Maikell-Victor-Quimica-2024-Volume-2.pdfMaikell-Victor-Quimica-2024-Volume-2.pdf
Maikell-Victor-Quimica-2024-Volume-2.pdf
 
Calidad de vida laboral - Ética y Responsabilidad Social Empresarial
Calidad de vida laboral - Ética y Responsabilidad Social EmpresarialCalidad de vida laboral - Ética y Responsabilidad Social Empresarial
Calidad de vida laboral - Ética y Responsabilidad Social Empresarial
 
FRASE CÉLEBRE OLÍMPICA EN ROMPECABEZAS. Por JAVIER SOLIS NOYOLA
FRASE CÉLEBRE OLÍMPICA EN ROMPECABEZAS. Por JAVIER SOLIS NOYOLAFRASE CÉLEBRE OLÍMPICA EN ROMPECABEZAS. Por JAVIER SOLIS NOYOLA
FRASE CÉLEBRE OLÍMPICA EN ROMPECABEZAS. Por JAVIER SOLIS NOYOLA
 
Mapa-conceptual-de-la-Evolucion-del-Hombre-3.pptx
Mapa-conceptual-de-la-Evolucion-del-Hombre-3.pptxMapa-conceptual-de-la-Evolucion-del-Hombre-3.pptx
Mapa-conceptual-de-la-Evolucion-del-Hombre-3.pptx
 
5° T3 EDITABLE EVALUACIÓN DARUKEL 2023-2024.pdf
5° T3 EDITABLE EVALUACIÓN DARUKEL 2023-2024.pdf5° T3 EDITABLE EVALUACIÓN DARUKEL 2023-2024.pdf
5° T3 EDITABLE EVALUACIÓN DARUKEL 2023-2024.pdf
 
Gui_a para el uso de IA generativa en educacio_n e investigacio_n - UNESCO.pdf
Gui_a para el uso de IA generativa en educacio_n e investigacio_n - UNESCO.pdfGui_a para el uso de IA generativa en educacio_n e investigacio_n - UNESCO.pdf
Gui_a para el uso de IA generativa en educacio_n e investigacio_n - UNESCO.pdf
 
Sesión: Los acontecimientos finales de la tierra
Sesión: Los acontecimientos finales de la tierraSesión: Los acontecimientos finales de la tierra
Sesión: Los acontecimientos finales de la tierra
 
REGIMÉN ACADÉMICO PARA LA EDUCACIÓN SECUNDARIA - RESOC-2024-1650-GDEBA-DGC...
REGIMÉN ACADÉMICO PARA LA EDUCACIÓN SECUNDARIA - RESOC-2024-1650-GDEBA-DGC...REGIMÉN ACADÉMICO PARA LA EDUCACIÓN SECUNDARIA - RESOC-2024-1650-GDEBA-DGC...
REGIMÉN ACADÉMICO PARA LA EDUCACIÓN SECUNDARIA - RESOC-2024-1650-GDEBA-DGC...
 
Evaluacion-Formativa-Nueva Escuela Mexicana NEM-ok.pdf
Evaluacion-Formativa-Nueva Escuela Mexicana NEM-ok.pdfEvaluacion-Formativa-Nueva Escuela Mexicana NEM-ok.pdf
Evaluacion-Formativa-Nueva Escuela Mexicana NEM-ok.pdf
 
Fundamentos metodología deenseñanza.pptx
Fundamentos metodología deenseñanza.pptxFundamentos metodología deenseñanza.pptx
Fundamentos metodología deenseñanza.pptx
 
Jesús calma la tempestad el mar de en.docx
Jesús calma la tempestad el mar de en.docxJesús calma la tempestad el mar de en.docx
Jesús calma la tempestad el mar de en.docx
 

Genetica2015

  • 2. TAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCT GACTGAAGGCTTGAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAG CCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCT TGAGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAGCCTTAC CTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGGCC AGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAGCCTTACCTTAACC TAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGAGCTATTATC CTAGGCGCATTAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACG GCTGCTAGCTGACTGAAGGCTTGAGGCCAGCTATATTAGCCTATATATCCTAGG CGCATTAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGC TAGCTGACTGAAGGCTTGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAG CTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGAC TGAAGGCTTGAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAGCCT TACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTG AGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAGCCTTACCT TAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGCTAGC TGACTGAAGGCTTGAGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAGCT AGCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTG AAGGCTTGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGGGCTG CTAGCTGACTCTAGCCTTACCTTAACCTACCTAAACCTAGGCCTAGCCTACGGCTGCTA GCTGACTGAAGGCTTGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGGGCTGCT AGCTGACTCTAGCCTTACCTTAACCTCCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTG AAGGCTTGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGGGCTGCTAGCTGACT CTAGCCTTACCTTAACCTCTGACTCTAGCCTTACCTTAACCTCTGACTCTAGCCTTACC EL LIBRO DE LA VIDA
  • 3.
  • 4. Estructura del cromosoma metafásico El cromosoma metafásico está constituido por dos cromátidas unidas por el centrómero que divide al cromosoma en dos brazos. BRAZO BRAZO Cinetocoro Centrómero Constricciones secundarias Telómero Bandas
  • 5.
  • 6.
  • 7.
  • 8. CONCEPTO DE GEN • Gen: fragmento de ADN que contiene la información para un determinado carácter.(proteína para que se exprese un carácter)
  • 9. ESTRUCTURA DEL GENOMA • GENOMA: Conjunto completo de genes. • NO todo el ADN codifica para proteínas. La mayoría son gene reguladores de otros genes o fragmentos de función desconocida.
  • 10. MUTACIONES • Cambios aleatorios que se producen en el ADN de un organismo. • Fuente de variabilidad genética y motor de la evolución. • VIDEO
  • 14. VIDEOS GENÉTICA • http://recursos.cnice.mec.es /biosfera/alumno/2bachillerato/biomol /actividades/videocromatina/ cromatina.htm • http://recursos.cnice.mec.es /biosfera/alumno/2bachillerato/biomol /actividades/videoadn/adn.htm
  • 16. • Gen: fragmento de ADN que contiene la información necesaria para determinar un carácter hereditario. • La posición de un gen en un cromosoma se denomina loci. • Organismos diploides cada carácter viene determinado por una pareja de genes. A las diversas alternativas se llaman ALELO.
  • 17. • Genotipo: conjunto de genes que posee un individuo y que ha heredado de sus progenitores. • Fenotipo: Conjunto de caracteres que manifiesta un organismo.
  • 18. GENÉTICA MENDELIANA • GENETICA: Es la ciencia que se encarga del estudio de los mecanismos de la herencia y las leyes por las que se rige. • Mendel demostró que los caracteres hereditarios estaban determinados por factores independientes que se transmitían de generación en generación. -- GENES.
  • 20.
  • 21.
  • 22.
  • 23.
  • 25. • Cuando uno de los alelos se manifiesta se dice que el alelo es dominante. • El alelo que no se manifiesta es el alelo recesivo. PRÁCTICA
  • 27.
  • 28.
  • 29.
  • 30.
  • 31. • Hay caracteres que no siguen las reglas de la herencia mendeliana. • Esto pasa en los siguientes casos: • Herencia intermedia y codominancia. • Herencia ligada al sexo. • Herencia poligénica.
  • 32. Herencia intermedia Si ambos alelos expresan por igual su información el resultado es un individuo con características intermedias entre ambos progenitores.
  • 33. En cierta especie de plantas los colores de las flores pueden ser rojos, blancos o rosas. Se sabe que este carácter está determinado por dos genes alelos, rojo (CR) y blanco (CB) codominantes. ¿Cómo podrán ser los descendientes del cruce entre plantas de flores rosas con plantas de flores rojas? Haz un esquema de cruzamiento
  • 34. • Codominancia: Si los dos alelos se manifiestan simultáneamente en el individuo. PRACTICA SI TODAVIA NO LO VES CLARO Y QUIERES PRACTICAR, AQUÍ TIENES UN ENL
  • 35. La herencia de los grupos sanguíneos. Codominancia Toda persona tiene alguno de estos cuatro grupos sanguíneos: A B AB O El grupo sanguíneo está determinado por los genes Antes de hacer una transfusión sanguínea, hay que tener presentes los grupos del DONANTE y del RECEPTOR La transfusión de sangre es el procedimiento médico de incorporar sangre o sus derivados procedentes de un individuo en el sistema circulatorio de otro, utilizado para mantener con vida a los pacientes que han sufrido pérdidas excesivas de sangre por traumas o cirugía, o para proporcionar algún elemento necesario en caso de enfermedades que afectan la producción de glóbulos rojos, blancos o algún otro componente sanguíneo
  • 36. La herencia de los grupos sanguíneos. Codominancia Toda persona tiene alguno de estos cuatro grupos sanguíneos: A B AB O El grupo sanguíneo está determinado por los genes El grupo sanguíneo depende de la ausencia o presencia de los ANTÍGENOS A y B en la sangre, y la expresión de estos está controlada por tres posibles alelos: el A, el B y el O A = B > O Son codominantes entre sí Dominan por igual al alelo O
  • 37. La herencia de los grupos sanguíneos. Codominancia Los glóbulos rojos son células sanguíneas en cuya membrana hay unas moléculas que se comportan como antígenos (1) cuando entran en la sangre de otra persona. Membrana celular Molécula antigénica Glóbulo rojo (1) Los antígenos son un tipo de proteínas que reaccionan con otro tipo de proteína llamada ANTICUERPO o aglutinina. En esta reacción se unen y se produce la aglutinación de la sangre (2). Lo vimos en 3º E.S.O. ANTÍGENO ANTICUERPO Se unen las dos moléculas (2) Cuando hay aglutinación se forman coágulos de sangre que pueden ocasionar la muerte de la persona receptora.
  • 38. Anticuerpo anti-BAntígeno A Antígeno B Antígeno A Antígeno B Ningún antígeno A B AB O Grupos Antígenos Anticuerpos del plasma sanguíneo Anticuerpo anti-A Ningún anticuerpo Anticuerpo anti-B Anticuerpo anti-A y y Estos son los antígenos que hay en los glóbulos rojos de las personas A, B, AB y O
  • 39. + provoca reacción - no provoca reacción
  • 40. 6 Reproducción y herencia Biología y Geología 4.º ESO POSIBILIDADES SANGUÍNEAS ¿Pueden tener dos personas tipo A un hijo con sangre cero? AO → Tipo A XAO AO A OO A AA AO OOAOGenotipo Fenotipo A A A O Dos personas tipo A pueden tener un 75% de posibilidades de tener un hijo A y 25% de tener un hijo O. Imposible B o AB. ¿Pueden tener un AB un hijo de sangre O? XAB OO A OB O AO BO BOAOGenotipo Fenotipo A A B B Una persona AB no puede tener un hijo de tipo O Una persona AB con otra O sólo pueden tener hijos A ó B.
  • 41. 7 Reproducción y herencia Biología y Geología 4.º ESO POSIBILIDADES SANGUÍNEAS 2 ¿Pueden tener dos personas tener un hijo con cualquier tipo de sangre? XAO BO A OO B AB BO OOAOGenotipo Fenotipo AB A B O Vemos que hay cualquier posibilidad ¿Qué pasa con los RH? X+- +- + -- + ++ +- --+-Genotipo Fenotipo + + + - Dos personas positivas pueden tener hijo negativo ¿Pueden tener dos negativas tener un hijo positivo? (+) Es dominante frente al (-)
  • 42. INICIO ESQUEMA RECURSOS INTERNET Formas de determinación genética del sexo SALIRANTERIOR Determinación cromosómica Determinación ambiental Determinación cariotípica Determinación génica Cariotipo de saltamontes Pepinillo del diablo (Ecballium elaterium) Cola de espada (Xiphophorus) Abejas
  • 43. INICIO ESQUEMA RECURSOS INTERNET Determinación genética del sexo en la especie humana SALIRANTERIOR Cada óvulo tiene 22 autosomas y un cromosoma X La mitad de los espermatozoides llevan 22 autosomas y un cromosoma X, y la otra mitad 22 autosomas y un cromosoma Y
  • 44. • Síndrome Down – Fertilidad reducida 50% • XYY- “Superhombre” – Fértil • XXY- Síndrome de Kinelfelter. Hombre. “Hipogonadismo” – No fertil por falta de hormonas. • XXX- “Supermujer” Síndrome triple X. Fértil. • X0 – Síndrome de Turner – Mujer. No fértil.
  • 45. X YX Y Región diferencialRegión diferencial cromosoma Xcromosoma X Región diferencial cromosoma Y RegiónRegión homólogahomóloga Región homólogaRegión homóloga • Machos son hemicigotos para los genes localizadosMachos son hemicigotos para los genes localizados en la región diferencial.en la región diferencial. • Los genes localizados en la región homóloga seLos genes localizados en la región homóloga se comportan como genes localizados en autosomascomportan como genes localizados en autosomas • HERENCIA LIGADA AL CROMOSOMA XHERENCIA LIGADA AL CROMOSOMA X genesgenes localizados en la región diferencial del cromosoma Xlocalizados en la región diferencial del cromosoma X • HERENCIA LIGADA AL CROMOSOMA YHERENCIA LIGADA AL CROMOSOMA Y genesgenes localizados en la región diferencial del cromosoma Ylocalizados en la región diferencial del cromosoma Y ““Homo sapiens”Homo sapiens” 2n= 46 (44 autosomas y XX o XY)2n= 46 (44 autosomas y XX o XY)
  • 46. INFLUENCIA DEL SEXO EN LA HERENCIA 1.- HERENCIA INFLUIADA POR EL SEXO En algunos caracteres monogénicos, la relación de dominancia entre los dos alelos depende del sexo Ej.: Calvicie en humanos Presencia de cuernos en vacuno 2.- LIMITACIÓN DE LA EXPRESIÓN DEL CARÁCTER CON EL SEXO Un carácter puede expresarse solo en uno de los sexos- generalmente debido a la presencia o ausencia de una hormona. Ej.: La letalidad puede estar limitada al sexo
  • 47.
  • 48.
  • 49. Herencia ligada al sexo ¿Qué es la hemofilia? La hemofilia es un trastorno hemorrágico o de coagulación hereditario. Los niños que tienen hemofilia carecen de la capacidad de detener una hemorragia debido a que su sangre presenta bajos niveles, o ausencia total, de unas proteínas específicas denominadas "factores" que son necesarias para la coagulación. La correcta coagulación sanguínea ayuda a prevenir el sangrado excesivo.
  • 50.
  • 51.
  • 52. • Ciertos caracteres, como el daltonismo, están determinados por un gen recesivo (d) ligado al cromosoma X. ¿Cómo podrán ser los descendientes de un hombre daltónico y una mujer no daltónica, hija de un hombre daltónico? Haz un esquema de cruzamiento.
  • 53. Otra alteración debida a un alelo recesivo es el DALTONISMO. Consiste en una alteración en la correcta visión de los colores. Una persona daltónica es incapaz de distinguir en estas láminas los números 182 y 13 ¿Qué ves en estas láminas?
  • 54.
  • 55.
  • 56.
  • 57.
  • 58. CARACTERES DOMINANTES LIGADOSCARACTERES DOMINANTES LIGADOS AL CROMOSOMA XAL CROMOSOMA X -- Los machos afectados transmiten la “condición “Los machos afectados transmiten la “condición “ aa todas sus hijastodas sus hijas, pero a, pero a ningún hijoningún hijo - Las hembras afectadas transmiten la- Las hembras afectadas transmiten la condición a lacondición a la mitad de sus descendientesmitad de sus descendientes tantotanto machos como hembrasmachos como hembras Ej.: HipofosfatemiaEj.: Hipofosfatemia
  • 60.
  • 61.
  • 62.
  • 63.
  • 64. Padres Enfermos Hijos sanos CARÁCTER DOMINANTE aa Aa Aa CARÁCTER RECESIVO
  • 65.
  • 66. Padres sanos Hijos enfermos CARÁCTER RECESIVO CARÁCTER DOMINANTE. Padres enfermos, hijos sanos
  • 67.
  • 68. PLEIOTROPÍA • Un gen que afecta a mas de una característica • Ejemplo gen w en felinos: produce color blanco y sordera • El gen mirlo en Collie: manchas grises, microftalmia, hipoacusia
  • 70. El gen Manx (letal y pleiotrópico y deletéreo) • El gen Manx (M) es el que, en los animales heterocigotas Mm, produce el fenotipo ausencia de cola. • En Homocigosis dominante (MM) es Letal. • En homocigosis recesiva mm produce gatos normales con cola.
  • 71. GEN DOMINANTE CON EFECTO LETAL RECESIVO GATO MANX (Falta de cola) ML / ML Letal ML / M Sin cola M / M Normal
  • 72. Problema • No es fácil encontrar pelos en los perros calvos mejicanos. En los cruces entre perros calvos mejicanos y perros normales se obtienen camadas con la mitad de los animales calvos y la otra mitad normales. Por otro lado, en los cruces entre perros calvos mejicanos, 2/3 de la camada son calvos y 1/3 con pelo. • Además de estos supervivientes, normalmente aparecen también perros muertos. Estos son calvos y presentan la misma frecuencia que los que tienen pelo. Da una explicación y representa los genotipos de los diferentes tipos de animales.
  • 74. EPISTASIAS • Las epistasias se producen cuando el carácter estudiado está gobernado por más un locus. • La situación más sencilla que podemos imaginar sería la de un carácter controlado por dos loci, cada locus con un par de alelos: A,a y B,b. • En este caso, se producen cuando existe influencia entre alelos de distintos loci (influencia de los alelos A y a sobre los alelos B y b y viceversa).
  • 75. Dos genes afectando al mismo carácter 1.- Sin modificación de la proporción 9:3:3:1 Ej: Forma de la cresta en las aves de corral 2.- Modificación de las proporción 9:3:3:1 EPISTASIA Dominante 12 : 3 : 1 Reccesiva 9 : 3 : 4 Dominante (genes duplicados) 15 : 1 Recesiva (genes complementarios) 9 : 7 Dominante y Recesiva 13 : 3 SIMPLE DOBLE
  • 76. Interacciones entre genes: Epistasias (≠9:3:3:1) epistasia: ‘predominar sobre’ gen epistático inhibe la acción del gen hipostático
  • 77. O = pigmento naranja B = pigmento negro EPISTASIA Sin modificación de la segregación 9:3:3:1 en la serpiente del maíz
  • 78. EPISTASIA SIMPLE DOMINANTE • El alelo dominante de uno de los dos loci (por ejemplo el alelo A) suprime la acción de los alelos B y b del otro locus. • En el caso de las mazorcas de maíz. El alelo dominante del locus A produce color Púrpura en la aleurona (proteína externa) que impide ver color del endospermo, solamente cuando las plantas son aa (aleurona incolora) es posible observar el color del endospermo que está controlado por un locus cuyo alelo dominante B da lugar a pigmento amarillo y el recesivo b bloque la síntesis de dicho pigmento.
  • 79.
  • 80. Negro 9/16A_b_ Castaño 3/16 aaB_ Oro 3/16 A_bb 1/16 aabb
  • 81.
  • 82. • aaB_: amarillo con almohadillas, hocico negro y rimmel • aabb: amarillo con despigmentación general
  • 83.
  • 84. FENOTIPOS 9 púrpuras : 7 blancas genes complementarios Epistasia doble recesiva (9:7)
  • 85.
  • 86. EPISTASIA DOBLE DOMINANTE RECESIVA 13:3 Ej. Color en pelaje de mamíferos: conejos himalaya y gatos siameses C - Permite pigmento ( melanina) > c – albino I – Inhibe pigmento > i permite pigmento cb - pigmento solo depositado zonas dependiendo del calor corporal. Zonas cálidas no producen melanina. En Tª baja como extremidades, orejas, cola, pies, hocico, produce melanina.
  • 87.
  • 88. Dos loci independientes,( A Y b, B) controlan el color en el pelo. El alelo A produce melanina, el alelo a no produce. El alelo B es un inhibidor de la pigmentación porque no permite la producción del producto intermediario (DOPA). El b si produce el intermediario
  • 89. FENOTIPO DEPENDIENTE DE VARIOS GENES. INTERACCIONES ENTRE GENES • Además hay más genes: Cromosoma 15  Densidad del Estroma Poligénico: AA, Aa, aa http://genetics.thetech.org/online-exhibits/what-color-eyes-will-your-children-have
  • 90. Herencia poligénica • Carácter determinados por la acción de más de un gen que pueden tener además más de dos alelos, lo cual origina numerosas combinaciones que son la causa de que exista una gradación en los fenotipos; es típico de caracteres cuantitativos, es decir, que se pueden medir con alguna unidad de medida (peso, altura, longitud de las patas, número de granos por espiga, número de huevos, litros de leche, etc.). • También se debe a este tipo de herencia el color de la piel en nuestra especie, por eso existen tantas posibilidades y tanta variación del color de la piel entre blancos y negros.
  • 91. • Posibles tonos de piel con su respectivo genotipo, indicando la influencia de los alelos dominantes en el tono del color.
  • 92. • Distribución de los fenotipos de la F2 en una curva. Los tonos que se obtienen en la piel en seres humanos puede ser explicada si se asume que éstos están bajo el control de tres pares de alelos. Si un individuo trihíbrido se cruza con otro trihíbrido, el rango de tonos que se pueden obtener se ilustran en el cuadro de Punnett. El número de alelos dominantes de cada individuo está representado por un número de círculos oscuros.
  • 93. 11. La polygénie (gènes cumulatifs ou quantitatifs) C’est le fait que plusieurs gènes «situés à des locus différents» influencent un seul aspect du phénotype (un seul caractère). Les effets de ces gènes s'additionnent et produisent différents résultats intermédiaires (variation continue d'un caractère). La taille des individus d’une population est aussi déterminée par plusieurs paires de gènes. La couleur de la peau dépend de (3) paires de gènes. Albinos Très noir Campbell (3e éd.) — Figure 14.12 : 284
  • 94. 94 Penetrancia y expresividad Ambos conceptos se refieren a la expresión fenotípica variable de ciertos genes Penetrancia: Proporción de individuos en una población que presentan el fenotipo correspondiente a su genotipo. Si P < 1 se habla de penetrancia incompleta Expresividad: El grado de expresión individual de un fenotipo para un genotipo dado
  • 95. 95 Expresividad 10 grados de expresividad variable en el carácter piel manchada en perros.
  • 96. 96 •Impronta parental •Ejemplo Factor crecimiento II tipo insulina (Igf2) en ratón. Mutante homocigoto -> enano. El fenotipo del heterocigoto depende del origen del alelo Alelo salvaje es paterno -> fenotipo salvaje Alelo salvaje es materno -> fenotipo enano •Edad de aparición de un fenotipo •Temprana •Tardía Aparición tardía de la enfermedad de Huntington
  • 97. • En los ratones de campo existe un gen que determina el color pelo amarillo y que es dominante sobre el que determina el color normal o de tipo salvaje. El tamaño de la cola esta determinada por una pareja alélica, de tal manera que el gen dominante determina tamaño de cola corta mientras que el recesivo determina tamaño normal o de tipo salvaje. Ambas parejas de genes se transmiten a la descendencia independientemente la una de la otra. Aquellos embriones que son homocigotos para uno o para los dos genes dominantes mueren antes de nacer. ¿En qué proporción y cómo serán los fenotipos de la descendencia de un cruzamiento entre un macho de color amarillo y cola corta con una hembra de las mismas características?
  • 98.
  • 99. Gemelos y Mellizos • GEMELOS 1 óvulo + 1 espermatozoide + suerte • MELLIZOS: 2 óvulos + 2 espermatozoides
  • 100.
  • 101.
  • 102.
  • 103.
  • 104.
  • 106.
  • 107.
  • 108. INICIO ESQUEMA RECURSOS INTERNET Meiosis y ciclos biológicos SALIRANTERIOR Ciclo diplonte Ciclo haplonte Ciclo diplohaplonte
  • 109. INICIO ESQUEMA RECURSOS INTERNET Meiosis y ciclos biológicos SALIRANTERIOR Ciclo haplonte VOLVER En algas y hongos unicelulares HAPLOIDE DIPLOIDEDIPLOIDE Cigoto (2n) Fecundación Meiosis Célula (n) Gametos (n) Fusión de gametos
  • 110. INICIO ESQUEMA RECURSOS INTERNET Meiosis y ciclos biológicos SALIRANTERIOR Ciclo diplohaplonte VOLVER En plantas y en algunas algas y hongos Gametos (n) HAPLOIDE DIPLOIDEDIPLOIDE Fecundación Meiosis Esporas (n) Cigoto (2n) (n) (2n)
  • 111. INICIO ESQUEMA RECURSOS INTERNET Meiosis y ciclos biológicos SALIRANTERIOR Ciclo diplonte VOLVER En casi todos los animales HAPLOIDEDIPLOIDEDIPLOIDE Fecundación Cigoto (2n) Gametos (n) (2n)